لیست قیمت و محصولات PCR, qPCR & Related - محصولات مرتبط با PCR & qPCR


آیا سوالی دارید؟ با ما تماس بگیرید.تلفن: (021)44260285(4 خط) - تلگرام: +989391127651

جستجو در میان محصولات

نمایش همه محصولات

همه محصولات موجود

آخرین به روز رسانی: 1400-06-30 09:01 | 41 کالای موجود
محصول شماره کاتالوگ اندازه قیمت (ریال) تولیدکننده افزودن به سبد
ROX Reference Dye II (50X conc.) 100 ul - ROX Reference Dye II (50X conc.) 100 ul - 100µl 1,950,000 TaKaRa - تاکارا افزودن به سبد خرید
Buffer H 1000 - 950,000 TaKaRa - تاکارا افزودن به سبد خرید
Bgl I 1000 units 1020A 1000U 6,950,000 TaKaRa - تاکارا افزودن به سبد خرید
Eco T22 I Ava III Nsil 2000u TaKara - آنزیم محدودکننده Eco T22 I (Ava III) (Nsil) 2000u 1125A 2000 u 14,500,000 TaKaRa - تاکارا افزودن به سبد خرید
Asu II-2500 u TaKaRa - آنزیم محدودکننده Asu II-2500 u 1225A 2500 u 12,000,000 TaKaRa - تاکارا افزودن به سبد خرید
Advantage® 2 PCRKit 639207-30Rxns - 69,500,000 TaKaRa - تاکارا افزودن به سبد خرید
10X Takara Taq Buffer (Mg2+ free) - - 9151AM-1ML - 1,950,000 TaKaRa - تاکارا افزودن به سبد خرید
2X GC Buffer I 9154-1.25ml - 1,500,000 TaKaRa - تاکارا افزودن به سبد خرید
2X GC Buffer II - بافر 2X GC II 9155 1.25ml 1,950,000 TaKaRa - تاکارا افزودن به سبد خرید
Loading buffer -10X 1vial 9157-1Vial vials 1,200,000 TaKaRa - تاکارا افزودن به سبد خرید
Esay Dilution-1ML 9160-1ML - 2,950,000 TaKaRa - تاکارا افزودن به سبد خرید
TSG DNA POLYMERASE, 5U/UL.SIZE. 200 - DNA پلیمراز TSG D0081-200U 200u 2,950,000 BioBasic - بایوبیسیک افزودن به سبد خرید
dNTP mixture (10mM) 0.5ML DD0056-0.5ml 0.5ml 6,950,000 BioBasic - بایوبیسیک افزودن به سبد خرید
DNAfectamine DNAF001-0.1ML - 14,950,000 BioBasic - بایوبیسیک افزودن به سبد خرید
DNAfectamine DNAF001-0.3ML - 36,500,000 BioBasic - بایوبیسیک افزودن به سبد خرید
DNASE I, RNASE FREE.SIZE.1000U EADN01-1000U - 5,950,000 Aminsan - امینسان افزودن به سبد خرید
TAQ DNA POLYMERASE (HIGH PURITY),50U/UL.SIZE.1KU - تک دی ان ای پلیمراز های پیوریتی HTD0078 1000U 7,500,000 BioBasic - بایوبیسیک افزودن به سبد خرید
TAQ DNA POLYMERASE-500U - - HTD0078 - 4,500,000 BioBasic - بایوبیسیک افزودن به سبد خرید
10x Taq Buffer (MgCl2)1.5ml PCRB16-1.5ml 950,000 BioBasic - بایوبیسیک افزودن به سبد خرید
10x Taq Buffer (NH4)2SO4.SIZE.1.5ml PCRB55-1.5ML 950,000 BioBasic - بایوبیسیک افزودن به سبد خرید
10xTaq Buffer.SIZE.1.5ml PCRB60-1.5ml 1.5ml 950,000 BioBasic - بایوبیسیک افزودن به سبد خرید
Green-2-Go 2X qPCR-S Mastermix QPCR004-S-1.25ML - 7,500,000 BioBasic - بایوبیسیک افزودن به سبد خرید
Hs_ALPL_1_SG QuantiTect Primer Assay (200) Qiagen - پرایمر اختصاصی ALP QT00012957 Pack 25,000,000 Qiagen - کیاژن افزودن به سبد خرید
Hs_SPARC_1_SG QuantiTect Primer Assay (200) Qiagen - پرایمر اختصاصی SPARC QT00018620 Pack 25,000,000 Qiagen - کیاژن افزودن به سبد خرید
Hs-RB1-1-SG QuantiTect primer assay (200)Qiagen - پرایمر اختصاصی RB1 QT00066899 Pack 25,000,000 Qiagen - کیاژن افزودن به سبد خرید
Hs_BGLAP_1_SG QuantiTect Primer Assay (200) Qiagen - پرایمر اختصاصی BGLAP QT00232771 Pack 25,000,000 Qiagen - کیاژن افزودن به سبد خرید
Hs_SPP1_1_SG QuantiTect Primer Assay (200) Qiagen - پرایمر اختصاصی SPP1 QT01008798 Pack 25,000,000 Qiagen - کیاژن افزودن به سبد خرید
Taq DNA polymerase 50 unit - - R001Q - 3,950,000 TaKaRa - تاکارا افزودن به سبد خرید
TaKaRa Taq Hot Start 50 units - - R007Q - 4,950,000 TaKaRa - تاکارا افزودن به سبد خرید
Mgcl2 PCR-Grade 50mM-1.25ml R01050-0125 - 350,000 Aminsan - امینسان افزودن به سبد خرید
Prime Star 50unit R010Q - 25,500,000 TaKaRa - تاکارا افزودن به سبد خرید
MgSO4 PCR-Grade 100mM R02100-0125 - 350,000 Aminsan - امینسان افزودن به سبد خرید
RNase A 25mg - آنزیم RNase A RB0473 25mg 5,950,000 BioBasic - بایوبیسیک افزودن به سبد خرید
TaKaRa EX Taq Hot Start 50 units - - RR006Q - 6,950,000 TaKaRa - تاکارا افزودن به سبد خرید
EmeraldAmp MaxHS PCR Master Mix TaKaRa 40t RR330Q 1 ml  16,950,000 TaKaRa - تاکارا افزودن به سبد خرید
Premix Ex Taq Probe qPCR 200rxns RR390A - 48,000,000 TaKaRa - تاکارا افزودن به سبد خرید
Premix Ex Taq TM Probe qPCR 40rxns - مسترمیکس پروب Real time PCR TaqMan RR390Q 1ml 9,950,000 TaKaRa - تاکارا افزودن به سبد خرید
SYBR Premix Ex Taq2 (Tli Plus) 20T RR820Q-0.5ml - 5,500,000 TaKaRa - تاکارا افزودن به سبد خرید
High purity PCR Master Mix - مستر میکس PCR 2X با خلوص بالا SP001-40-1ml 1 mL 1,100,000 Aminsan - امینسان افزودن به سبد خرید
Aminsan Green 2X PCR Master Mix SP002-40 - 1,350,000 Aminsan - امینسان افزودن به سبد خرید
water nuclease free PCR grade-1.25ML - آب مقطر بدون نوکلئاز امینسان، مناسب برای تکنیک های مولکولی WA001-0125 1.25 mL 250,000 Aminsan - امینسان افزودن به سبد خرید

محصولات ناموجود

# محصول شماره کاتالوگ اندازه قیمت (ریال) تولیدکننده
1 سنتز پرایمر Page 100nmol None ناموجود BioBasic
2 Buffer Z None ناموجود TaKaRa
3 Rox I 40 ul ناموجود TaKaRa
4 Prime STAR (high fidelity PCR) 50 u None ناموجود TaKaRa
5 Buffer Taq*10 None ناموجود TaKaRa
6 Buffer MgSo4 None ناموجود TaKaRa
7 4th WHO International Standard for HBV DNA for NAT 10/266 None ناموجود NIBSC
8 Buffer PCR 1000 1ml ناموجود TaKaRa
9 Buffer H 1000 Vial ناموجود TaKaRa
10 Buffer K 1000 1ml ناموجود TaKaRa
11 Buffer L 1000 1ml ناموجود TaKaRa
12 Buffer M 1000 1ml ناموجود TaKaRa
13 Acc I 1001A 100U ناموجود TaKaRa
14 Apa I 10000 units 1005A 10000u ناموجود TaKaRa
15 BamH I 1010A 10000 U ناموجود TaKaRa
16 Ban II 1012A 2000u ناموجود TaKaRa
17 Bcn I (Cau II ‘NCi1) 1019A 1,000 U ناموجود TaKaRa
18 Bgl II 1021A 2000 ناموجود TaKaRa
19 Bln I (Avr II) 1022A 400 Units ناموجود TaKaRa
20 Bsp1286 I (Sdu I) 1024A 500 Units ناموجود TaKaRa
21 Restriction Enzyme Cpo l 1035A ناموجود TaKaRa
22 Dra I AhaIII 4000u TakaRa 1037A 4000u ناموجود TaKaRa
23 EcoT14I (StyI) 1038A 3,000 Units ناموجود TaKaRa
24 EcoR I 10000 u آنزیم 1040A 10000 U ناموجود TaKaRa
25 EcoR V 3000 units 1042A 3000u ناموجود TaKaRa
26 Restriction Enzyme EcoO109 l 1043A ناموجود TaKaRa
27 Fba I (Bcl I) 1045A 500units ناموجود TaKaRa
28 Fok I 1046A 1,000 Units ناموجود TaKaRa
29 Hae III 1051A 4000Units ناموجود TaKaRa
30 Hae II 1052A 1000unit ناموجود TaKaRa
31 Hap II (Hpa II, Msp I) 1053A 2,000 Units ناموجود TaKaRa
32 Hha I 1056A 2,000 Units ناموجود TaKaRa
33 HincII (HindII) 1059A 1,000 Units ناموجود TaKaRa
34 Hind III 1060A 10000 U ناموجود TaKaRa
35 HpaI 1064A 500 Units ناموجود TaKaRa
36 Kpn I 1068A 5000u ناموجود TaKaRa
37 Mbo I 1000 units 1069A 1000u ناموجود TaKaRa
38 Mfl I (Xho II) 1070A 500 Units ناموجود TaKaRa
39 PstI 1073A 10,000 Units ناموجود TaKaRa
40 Sac I 1078A 2000 U ناموجود TaKaRa
41 Sac II 1000u 1079A 1000u ناموجود TaKaRa
42 Sal I 3000u TaKaRa 1080A 3,000 Units ناموجود TaKaRa
43 Sau3AI (MboI) 1082A 200 Units ناموجود TaKaRa
44 Sma I 1085A 2000u ناموجود TaKaRa
45 Spe I 300 units 1086A 300 units ناموجود TaKaRa
46 Xba I 1093A 3,000 Units ناموجود TaKaRa
47 Xho I 5000 u 1094A 5000U ناموجود TaKaRa
48 Xsp I (Bfa I, Mae I) 1095A 500 Units ناموجود TaKaRa
49 Dynabeads™ Human T-Expander CD3/CD28 11141D None ناموجود Thermo
50 Afa I (Rsa I ) 1000 units 1116A 1000U ناموجود TaKaRa
51 Eae I (Cfr I) 1123A 200 Units ناموجود TaKaRa
52 EcoO65I (BstEII, BstPI) 1135A 1,000 Units ناموجود TaKaRa
53 Mbo II 1145A 400Units ناموجود TaKaRa
54 Msp I (Hpa II) 1150A 3,000 Units ناموجود TaKaRa
55 Nae I 1155A 500Unit ناموجود TaKaRa
56 Nco I 500u TaKara 1160A 500Unit ناموجود TaKaRa
57 Nde I 1161A 400u ناموجود TaKaRa
58 Not I 500 units 1166A 500 U ناموجود TaKaRa
59 Taq I 1189A 2000u ناموجود TaKaRa
60 VpaK11B I (Ava II) 1196A 300 Units ناموجود TaKaRa
61 Dpn I Mal I 1000u TaKaRa 1235A 1,000 Units ناموجود TaKaRa
62 Hinf I 1238A 6000U ناموجود TaKaRa
63 Nhe I 1241A 700U ناموجود TaKaRa
64 Pvu II 1243A 4,000 Units ناموجود TaKaRa
65 SphI 1246A 600u ناموجود TaKaRa
66 Hepatitis C virus (HCV) For nucleic acid amplification techniques (5th International standard 2015) 14/150 None ناموجود NIBSC
67 Non WHO Reference Material 4th HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques 14/290 None ناموجود NIBSC
68 Invitrogen™ SuperScript™ III First-Strand Synthesis System- Invitrogen 18080051-50react None ناموجود Invitrogen
69 in vivo jetPEI Transfection Reagent (glucose inclus) 201-10G None ناموجود Poly Plus
70 T4 DNA ligase 25000 u 2011A 25000u ناموجود TaKaRa
71 Internal Control DNA (High conc.) 211392 None ناموجود Qiagen
72 Internal Control RNA (High conc.) 211492 None ناموجود Qiagen
73 DNA Polymerase I(E.coli) 2130A 500 Units ناموجود TaKaRa
74 Klenow Fragment 2140A 200unit ناموجود TaKaRa
75 Ribonuclease H (RNase H) 1000units TaKaRa 2150A 1000U ناموجود TaKaRa
76 Poly(A) Polymerase 2180A 20 Units ناموجود TaKaRa
77 Alkaline Phosphatase (Calf Intestine) 2250A 1000U ناموجود TaKaRa
78 Alkaline Phosphatase (Calf Intestine) 2250A 1000U ناموجود TaKaRa
79 Recombinant DNase I ,(RNase free) 2270A 1000u ناموجود TaKaRa
80 Recombinant RNase Inhibitor 2313A 5000u ناموجود TaKaRa
81 Recombinant RNase Inhibitor 2313Q 500U ناموجود TaKaRa
82 T7 RNA Polymerase 5000U 2540A 5000 U ناموجود TaKaRa
83 Exonuclease I 2650A 750 Units ناموجود TaKaRa
84 PrimeScript™ Reverse Transcriptase 2680A 10000u ناموجود TaKaRa
85 PrimeScript™ Reverse Transcriptase 2680Q 2000u ناموجود TaKaRa
86 BcaBEST DNA Polymerase 300U 2770Q 300u ناموجود TaKaRa
87 pUC 19 DNA 3219 None ناموجود TaKaRa
88 pRl201-AN DNA 3264 ناموجود TaKaRa
89 T-Vector pMD20 3270 1 ug ناموجود TaKaRa
90 Chaperone Plasmid Set 3340 1 Set ناموجود TaKaRa
91 pCold DNA Cold Shock Expression System 3360 1 Set ناموجود TaKaRa
92 CellAmp™ Direct RNA Prep Kit for RT-PCR (Real Time) 3732 200 Rxns ناموجود TaKaRa
93 dATP 4026 100 umol ناموجود TaKaRa
94 dGTP 4027 100 umol ناموجود TaKaRa
95 dCTP 4028 100 umol ناموجود TaKaRa
96 dTTP 4029 100 umol ناموجود TaKaRa
97 dNTP mixture 4030 1.28 ml ناموجود TaKaRa
98 میکرولیتر Dntp 180 4030 180ul ناموجود TaKaRa
99 cDNA synthesis kit: PrimeScript First Strand cDNA Synthesis Kit 6110A 50 Rxns ناموجود TaKaRa
100 3'-Full RACE Core Set 6121 20 react ناموجود TaKaRa
101 3'-Full RACE Core Set 6122 10 react ناموجود TaKaRa
102 PrimeScript II 1st strand cDNA synthesis kit 6210A Kit ناموجود TaKaRa
103 Lenti-XConcentrator 631231 None ناموجود TaKaRa
104 Lenti-X™ qRT-PCR Titration Kit 200 Rnx Clontech 631235 1kit ناموجود TaKaRa
105 Universal GenomeWalker 2.0 636405 None ناموجود TaKaRa
106 Real Time qPCR Master Mix - Terra qPCR Direct SYBR Premix 638319 ناموجود TaKaRa
107 SeqAmp DNA Polymerase 638504 None ناموجود TaKaRa
108 CloneAmp HiFi PCR Premix 639298-50rxns None ناموجود TaKaRa
109 HRV 3C Protease 500U 7360 None ناموجود TaKaRa
110 E. coli HB101 Competent Cells 9051 Set ناموجود TaKaRa
111 GC Buffer I 9154 1.25ml ناموجود TaKaRa
112 2X GC Buffer I 9154-1.5ml None ناموجود TaKaRa
113 Esay Dilution 1 pak 9160 1ml ناموجود TaKaRa
114 High Reverse Transcriptase (RNase H-, 10000 U) 9K-005-0005-10000U None ناموجود BioBasic
115 ATG39-2340bp Gene synthesis Sercive NEW SYNTHESIS OF AMINO082-01 None ناموجود BioBasic
116 Gene synthesis Service 2043bp ATG4 AMINO082-01 None ناموجود BioBasic
117 Gene synthesis Service 2691bp ATG5 AMINO082-02 None ناموجود BioBasic
118 ATG6 Gene synthesis Service mini gene AMINO082-03 None ناموجود BioBasic
119 ATG7-621bp Gene synthesis Service AMINO082-04 None ناموجود BioBasic
120 Gene synthesis Service 2001bp ATG8 AMINO082-05 None ناموجود BioBasic
121 ATG9-1944bp Gene synthesis Service AMINO082-06 None ناموجود BioBasic
122 ATG10-1206bp Gene synthesis Service AMINO082-07 None ناموجود BioBasic
123 Gene synthesis Service 1560bp ATG11 AMINO082-08 None ناموجود BioBasic
124 Gene synthesis Service 1011bp ATG12 AMINO082-09 None ناموجود BioBasic
125 Gene synthesis Service 1002bp ATG13 AMINO082-10 None ناموجود BioBasic
126 Gene synthesis Service 3327bp ATG14 AMINO082-11 None ناموجود BioBasic
127 Gene synthesis Service 2127bp ATG15 AMINO082-12 None ناموجود BioBasic
128 Gene synthesis Service 1392p ATG16 AMINO082-13 None ناموجود BioBasic
129 ATG17-762bp Gene synthesis Service AMINO082-14 None ناموجود BioBasic
130 ATG18-1215bp Gene synthesis Service AMINO082-15 None ناموجود BioBasic
131 Point mutation Service Mutagenesis of AMINO082-15 AMINO082-15- None ناموجود BioBasic
132 ATG19-1707bp Gene synthesis Service AMINO082-16 None ناموجود BioBasic
133 Gene synthesis Service 1098bp ATG20 AMINO082-17 None ناموجود BioBasic
134 ATG21-795bp Gene synthesis Service AMINO082-18 None ناموجود BioBasic
135 ATG22-867bp Gene synthesis Service AMINO082-19 None ناموجود BioBasic
136 Point mutation Service Mutagenesis of AMINO082-19 AMINO082-19- None ناموجود BioBasic
137 Taq DNA Polymerase, 5U/UL B0089 200u ناموجود BioBasic
138 Taq DNA Polymerase, 5U/UL B0089(D0089) 1000u ناموجود BioBasic
139 TAQ DNA POLYMERASE, 5U/UL.SIZE.500U B0089(D0089)-500U None ناموجود BioBasic
140 PFU DNA Polymerase,5U/UL 100U B0093(D0090P)-100U 100u ناموجود BioBasic
141 PFU DNA POLYMERASE, 5U/UL.SIZE.500U B0093(D0090P)-500U None ناموجود BioBasic
142 RNase H, 10U/UL BEN0202 500u ناموجود BioBasic
143 RNase I, 10U/UL BEN0601 1 Ku ناموجود BioBasic
144 Mini gene synthesis 151bp with subcloning pUC57 BHV1 None ناموجود BioBasic
145 Mini gene synthesis 204bp with subcloning pUC57 BPI3 None ناموجود BioBasic
146 Mini gene synthesis 252bp with subcloning pUC57 BRSV None ناموجود BioBasic
147 Mini gene synthesis 185bp with subcloning pUC57 BVDV1 None ناموجود BioBasic
148 Mini gene synthesis 193bp with subcloning pUC57 BVDV2 None ناموجود BioBasic
149 2'-Deoxythymidine-5'-triphosphate 100mM solution[dTTP], sodium salt D0046T 0-5ml ناموجود BioBasic
150 TSG DNA POLYMERASE, 5U/UL.SIZE. 200 u D0081-200u None ناموجود BioBasic
151 DNASE I, RNASE FREE.SIZE.50KU DD0649-50KU None ناموجود BioBasic
152 2'-Deoxyuridine-5'-triphosphate 100mMsolution (dUTP) DM1244-0.25ml None ناموجود BioBasic
153 Rnase A 10mg/ml EBRN01-1ml None ناموجود Aminsan
154 Alu I ER0011 600U ناموجود Thermo
155 MnlI ER1071 None ناموجود Thermo
156 Gene synthesis 336bp Gene Synthesis AMINO073 None ناموجود BioBasic
157 Oligo synthesis HAP Purification OD2 H510001-0002 None ناموجود BioBasic
158 5X All-In-One RT MasterMix (50ul) HRT025-10.25RXNS None ناموجود BioBasic
159 5X All-In-One RT MasterMix (200ul) HRT100-10.100RXNS None ناموجود BioBasic
160 5X All-In-One RT MasterMix (400ul) HRT200-10.SIZE.200 None ناموجود BioBasic
161 TAQ DNA POLYMERASE (HIGH PURITY),1u HTD0078-1u None ناموجود BioBasic
162 TAQ DNA POLYMERASE-200ul HTD0078-200ul 200u ناموجود BioBasic
163 Gene synthesis services 3877bp ATG37-AMINO098 - BioBasic J508021-0001 None ناموجود BioBasic
164 Gene synthesis 4320bp with subcloning pUC57 J508021-0001 None ناموجود BioBasic
165 Gene synthesis Service 9879bp (pATG2) Circularized-AMINO097-2 - BioBasic J508021-0001 None ناموجود BioBasic
166 Gene synthesis 1683bp AMINO070 J508021-0001 None ناموجود BioBasic
167 Gene synthesis Service ATG34 637bp-AMINO093 - J508021-0001 None ناموجود BioBasic
168 Subcloning Service pCDH-CMV J508022-0001 None ناموجود BioBasic
169 Subcloning service pET9a-AMINO093 - J508022-0001 None ناموجود BioBasic
170 Gene synthesis Service 8242bp (pATG1) Circularized-AMINO097-1 - BioBasic J508023-0001 None ناموجود BioBasic
171 Bst DNA Polymerase M0275S None ناموجود NEB
172 T7 Endonuclease I M0302S None ناموجود NEB
173 Bst 3.0 DNA Polymerase M0374L None ناموجود NEB
174 25mM MgCl2 MB1193 1.5ml ناموجود BioBasic
175 MgCl2 1.5ml MB1193-1.5ml 1.5ml ناموجود BioBasic
176 NTP Mixture (10mM) ND0056-0.5ML None ناموجود BioBasic
177 10x Taq Buffer (MgCl2) PCRB16 1.5ml ناموجود BioBasic
178 10x Taq Buffer (NH4)2SO4 PCRB55 1.5ml ناموجود BioBasic
179 10x PCR Buffer PCRB60 1.5ml ناموجود BioBasic
180 Mini gene synthesis 269bp with subcloning pUC57 PCV1 None ناموجود BioBasic
181 Mini gene synthesis 175bp with subcloning pUC57 PHEV1 None ناموجود BioBasic
182 Green-2-Go TaqProbe qPCR Mastermix-no Dye ) QPCR005-NODYE.1.25ML None ناموجود BioBasic
183 Green-2-Go 1-Step qRT-PCR Mastermix-No Dye (100X20ul Rxn) QPCR007-NODYE.100 None ناموجود BioBasic
184 Green-2-Go 1-Step TaqProbe qRT-PCR Mastermix-no Dye(100x20ul Rxn) QPCR008-NODYE.100 None ناموجود BioBasic
185 TaKaRa Taq™ DNA Polymerase R001A 250 Units ناموجود TaKaRa
186 TaKaRa Taq™ DNA Polymerase (with Mg2+ free buffer) R001AM 250 Units ناموجود TaKaRa
187 Pyrobest™ DNA Polymerase R005A 125 U ناموجود TaKaRa
188 PrimeSTAR HS DNA Polymerase 250 u R010A 250 Units ناموجود TaKaRa
189 PCR Amplificat_numberion Kit R011 100 Rxns ناموجود TaKaRa
190 NlaIII - 500 units DFS Item R0125S None ناموجود NEB
191 PrimeSTAR® GXL DNA Polymerase R050A 250 Units ناموجود TaKaRa
192 PrimeSTAR GXL DNA Ploymerase R050Q 50 Units ناموجود TaKaRa
193 Xcm I R0533S 1000U ناموجود NEB
194 Fse I, recombinant R0588S None ناموجود NEB
195 AsiS I, recombinant R0630S None ناموجود NEB
196 Methylation Specific PCR: EpiScope MSP Kit R100A 200 Rxns ناموجود TaKaRa
197 RNase A RB0473-100mg None ناموجود BioBasic
198 RNase A Solution (10mg/m.SIZE.1MLl) RB0474 ناموجود BioBasic
199 Ribonuclease inhibitor RB0478 5ku ناموجود BioBasic
200 Ribonuclease inhibitor.SIZE.1KU RB0478-1KU None ناموجود BioBasic
201 TaKaRa Ex Taq® DNA Polymerase RR001A 250unit ناموجود TaKaRa
202 A High Fidelity PCR Enzyme for Long Range PCR: LA Taq DNA Polymerase RR002A 125 Units ناموجود TaKaRa
203 TaKaRa LA Taq® DNA Polymerase (Mg2+ plus buffer) RR002M 250 Units ناموجود TaKaRa
204 TaKaRa EX Taq Hot Start 250 units RR006A None ناموجود TaKaRa
205 TaKaRa EX Taq Hot Start 20 units RR006Q-20U None ناموجود TaKaRa
206 PrimeScript RT-PCR Kit RR014A Kit ناموجود TaKaRa
207 TaKaRa Ex Taq Mg2+ free buffer RR01AM 250u ناموجود TaKaRa
208 Real Time one step RNA PCR kit, Version 2 RR026 100 Test ناموجود TaKaRa
209 cDNA Kit TaKaRa RR037A 200 react ناموجود TaKaRa
210 cDNA Kit TaKaRa-100rxns RR037A-100rxns None ناموجود TaKaRa
211 cDNA Kit TaKaRa-50rxns RR037A-50rxns None ناموجود TaKaRa
212 PrimeScript RT reagent Kit (PRT) 20 test RR037Q 20 react ناموجود TaKaRa
213 TaKaRa LA Taq HS (dNTP inclus) RR042Q None ناموجود TaKaRa
214 PrimeScript 1 Step RT-PCR Kit V2 50 react RR055A 50 react ناموجود TaKaRa
215 Multiplex PCR Assay Kit Ver.2 RR062A 100 Rxns ناموجود TaKaRa
216 One Step PrimeScript RT_PCR Kit 100 react. RR064A 100 react ناموجود TaKaRa
217 SpeedSTAR Taq 50 units RR070Q 50 Units ناموجود TaKaRa
218 One Step SYBRPrime Script RT-PCR 100react TaKaRa RR086A 100 react ناموجود TaKaRa
219 SYBR® Premix DimerEraser™ (Perfect Real Time) RR091A 200 Rxns ناموجود TaKaRa
220 EmeraldAmp GT PCR Master Mix TaKaRa 160t RR310A 4ml ناموجود TaKaRa
221 EmeraldAmp GT PCR Master Mix TaKaRa 40t RR310Q 1ml ناموجود TaKaRa
222 EmeraldAmp Max PCR Master Mix RR320A 4ml ناموجود TaKaRa
223 EmeraldAmp Max PCR Master Mix RR320Q 1ml ناموجود TaKaRa
224 EmeraldAmpMaxHS PCR Master Mix - (RR330A) RR330A 4ml ناموجود TaKaRa
225 EmeraldAmp MaxHS PCR Master Mix TaKaRa 160t RR330A 4ml ناموجود TaKaRa
226 SapphireAmp Fast PCR Master Mix160Test Takara RR350A 4 ml ناموجود TaKaRa
227 SapphireAmp Fast PCR Master Mix 40 Reaction Takara RR350Q 1 ml ناموجود TaKaRa
228 Premix Ex Taq (Probe qPCR) RR390L 5ml ناموجود TaKaRa
229 SYBR Premix Ex Taq2 (Tli Plus) 200T RR820A 200 Rxns ناموجود TaKaRa
230 SYBR Premix Ex Taq2 (Tli Rnase H Plus) 200T RR820L 5ml ناموجود TaKaRa
231 SYBR Premix Ex Taq2 (Tli Plus) 40T RR820Q 1ml ناموجود TaKaRa
232 SYBR Premix Ex Taq2 (Tli Plus) 25ml RR820W 25ml ناموجود TaKaRa
233 Mini gene synthesis 181bp with subcloning pUC57 Rabies V None ناموجود BioBasic
234 SYBR™ Green I Nucleic Acid Gel Stain - 10,000X concentrate S7563 None ناموجود Invitrogen
235 RetroNectin® Recombinant Human Fibronectin Fragment T100A 0.5 mg ناموجود TaKaRa
236 Retro Nectin T100B None ناموجود TaKaRa
237 RetroNectin® Pre-coated Dish T110A plates ناموجود TaKaRa
238 Mini gene synthesis 233bp with subcloning pUC57 TGEV None ناموجود BioBasic
239 water nuclease free PCR grade-1ML WA001-1ML None ناموجود Aminsan
241 oligo 32bp OD2 HPLC Purification 5`SH C6 oligo32bp None ناموجود BioBasic
242 Millieu de transfection des Plasmides sc-108062 None ناموجود Santa Cruz
243 Réactif de Transfection Ultracruz® sc-395739 None ناموجود Santa Cruz
244 Plasmide de Contrôle CRISPR/Cas9 sc-418922 None ناموجود Santa Cruz
245 AAUAAAGCGUUCUGUCAACC 20bp OD5 HPLC Purification siRNA1 None ناموجود BioBasic
246 GGAUGCUAUUGUGAAUGUGTT 21bp OD5 HPLC Purification siRNA3b None ناموجود BioBasic
247 سنتز ژن subcloning PUC57-803bp سنتز ژن subcloning P 804bp ناموجود BioBasic